Online Inquiry
MUTYH Knockout Cell Line
SPL-02202
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 5bp deletion |
| Target Information | |
|---|---|
| Target Name | MUTYH |
| Gene Abbr. | MUTYH |
| Gene ID | 4595 |
| Full Name | mutY DNA glycosylase |
| Alias | MYH |
| Species | Human |
| Genomic Locus | chr1:45333442 |
| Transcript | NM_001048171 |
| WT Expression Level | 19.21 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | This gene encodes a DNA glycosylase involved in oxidative DNA damage repair. The enzyme excises adenine bases from the DNA backbone at sites where adenine is inappropriately paired with guanine, cytosine, or 8-oxo-7,8-dihydroguanine, a major oxidatively damaged DNA lesion. The protein is localized to the nucleus and mitochondria. This gene product is thought to play a role in signaling apoptosis by the introduction of single-strand breaks following oxidative damage. Mutations in this gene result in heritable predisposition to colorectal cancer, termed MUTYH-associated polyposis (MAP). Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2017]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 5bp deletion in a coding exon of MUTYH. |
| Description | 5bp deletion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | CTTGGTCGTACCAGCTTAGC |
| PCR Primer |
Forward: CTCAGGAGATGTACTGACCAGCAT Reverse: GAAGCCCTAAGTGGGAGCATAC |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.