Online Inquiry
MUC1 cDNA ORF Clone, Human, N-FLAG tag
SPD-10538
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
Full length Clone DNA of Human mucin 1, cell surface associated, transcript variant 2 with N terminal Flag tag. |
Target Information | |
---|---|
Species | Human |
Target Name | MUC1 |
Gene Abbr. | MUC1 |
Gene ID | 4582 |
Full Name | mucin 1, cell surface associated |
Alias | ADMCKD, ADMCKD1, CA 15-3, CD227, EMA |
Introduction | Mucins represent a family of glycoproteins characterized by repeat domains and dense O-glycosylation. MUC1 (or mucin 1) is aberrantly overexpressed in most human carcinomas. Increased expression of MUC1 in carcinomas reduces cell-cell and cell-ECM interactions. MUC1 is cleaved proteolytically, and the large ectodomain can remain associated with the small 25 kDa carboxy-terminal domain that contains a transmembrane segment and a 72-residue cytoplasmic tail. MUC1 interacts with ErbB family receptors and potentiates ERK1/2 activation. MUC1 also interacts with β-catenin, which is regulated by GSK-3β, PKCγ, and Src through phosphorylation at Ser44, Thr41, and Tyr46 of the MUC1 cytoplasmic tail. Overexpression of MUC1 potentiates transformation and attenuates stress-induced apoptosis through the Akt or p53 pathways. |
Product Details | |
---|---|
Description | Full length Clone DNA of Human mucin 1, cell surface associated, transcript variant 2 with N terminal Flag tag. |
NCBI Ref Seq | NM_001018016.1 |
RefSeq ORF Size | 795 bp |
Sequence Information | Identical with the Gene Bank Ref. ID sequence. |
Vector | pCMV3-SP-N-FLAG |
Promoter | Enhanced CMV promoter |
Tag Sequence | FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG |
Restriction Sites | HindIII + XbaI (6kb + 0.81kb) |
Quality Control | The plasmid is confirmed by full-length sequencing. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
Usage | |
---|---|
Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
Antibiotic in E.coli | Kanamycin |
Antibiotic in Mammalian cell | Hygromycin |
Application | Stable or Transient mammalian expression |
Shipping | Each tube contains lyophilized plasmid. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.