Online Inquiry
MTMR3 Knockout Cell Line
SPL-02189
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 1bp insertion |
| Target Information | |
|---|---|
| Target Name | MTMR3 |
| Gene Abbr. | MTMR3 |
| Gene ID | 8897 |
| Full Name | myotubularin related protein 3 |
| Alias | FYVE-DSP1, ZFYVE10 |
| Species | Human |
| Genomic Locus | chr22:29978983 |
| Transcript | NM_021090 |
| WT Expression Level | 11.49 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | This gene encodes a member of the myotubularin dual specificity protein phosphatase gene family. The encoded protein is structurally similar to myotubularin but in addition contains a FYVE domain and an N-terminal PH-GRAM domain. The protein can self-associate and also form heteromers with another myotubularin related protein. The protein binds to phosphoinositide lipids through the PH-GRAM domain, and can hydrolyze phosphatidylinositol(3)-phosphate and phosphatidylinositol(3,5)-biphosphate in vitro. The encoded protein has been observed to have a perinuclear, possibly membrane-bound, distribution in cells, but it has also been found free in the cytoplasm. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 1bp insertion in a coding exon of MTMR3. |
| Description | 1bp insertion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | CAATGATGGCATCCTCGGCA |
| PCR Primer |
Forward: ACCCATCCTCTTTAGCTTCCTTATC Reverse: ATTCTGTATGCCTCTCCTCTCTTTG |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.