Online Inquiry
MTMR14 Knockout Cell Line
SPL-02188
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 5bp deletion |
| Target Information | |
|---|---|
| Target Name | MTMR14 |
| Gene Abbr. | MTMR14 |
| Gene ID | 64419 |
| Full Name | myotubularin related protein 14 |
| Alias | C3orf29 |
| Species | Human |
| Genomic Locus | chr3:9653676 |
| Transcript | NM_001077525 |
| WT Expression Level | 25.50 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | This gene encodes a myotubularin-related protein. The encoded protein is a phosphoinositide phosphatase that specifically dephosphorylates phosphatidylinositol 3,5-biphosphate and phosphatidylinositol 3-phosphate. Mutations in this gene are correlated with autosomal dominant centronuclear myopathy. Alternate splicing results in multiple transcript variants. A pseudogene of this gene is found on chromosome 18.[provided by RefSeq, Apr 2010]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 5bp deletion in a coding exon of MTMR14. |
| Description | 5bp deletion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | GCGTGATTCCAAACACGAAT |
| PCR Primer |
Forward: CTTAGGCCATGGACCTCCTAATTC Reverse: TCTGACTTGTCCAACCTTGAAGTAA |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.