MTMR1 Knockout Cell Line - CD BioSciences

service-banner

MTMR1 Knockout Cell Line

MTMR1 Knockout Cell Line

SPL-02183

Size Price
1 Unit Online Inquiry
Description
1bp insertion
Target Information
Target Name MTMR1
Gene Abbr. MTMR1
Gene ID 8776
Full Name myotubularin related protein 1
Species Human
Genomic Locus chrX:150699199
Transcript NM_003828
WT Expression Level 43.45 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing)
Introduction This gene encodes a member of the myotubularin related family of proteins. Members of this family contain the consensus sequence for the active site of protein tyrosine phosphatases. Alternatively spliced variants have been described but their biological validity has not been determined. [provided by RefSeq, Jul 2008].
Product Details
Cell Line Model HAP1
Genotype HAP1 cell line, edited by CRISPR/Cas to contain a 1bp insertion in a coding exon of MTMR1.
Description 1bp insertion
Parental Cell Line C631
Guide RNA Sequence CATTCAACATGTGATCCTGT
PCR Primer Forward: TTCCTAGTTGTCAGTCGCTATTTCA
Reverse: TTAAAACTGCAAAGCTTCTTGGCTA
Handling Specifications
Revival Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish.
Culture Medium IMDM + 10% FCS
Growth Properties Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20.
Freeze Medium IMDM + 20% FCS + 10% DMSO
Biosafety Level BSL-1
Disclaimer This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.