Online Inquiry
MSH6 Knockout Cell Line
SPL-02173
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 8bp deletion |
| Target Information | |
|---|---|
| Target Name | MSH6 |
| Gene Abbr. | MSH6 |
| Gene ID | 2956 |
| Full Name | mutS homolog 6 |
| Alias | GTBP, GTMBP, HNPCC5, HSAP, MMRCS3 |
| Species | Human |
| Genomic Locus | chr2:47790959 |
| Transcript | NM_000179 |
| WT Expression Level | 95.18 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | This gene encodes a member of the DNA mismatch repair MutS family. In E. coli, the MutS protein helps in the recognition of mismatched nucleotides prior to their repair. A highly conserved region of approximately 150 aa, called the Walker-A adenine nucleotide binding motif, exists in MutS homologs. The encoded protein heterodimerizes with MSH2 to form a mismatch recognition complex that functions as a bidirectional molecular switch that exchanges ADP and ATP as DNA mismatches are bound and dissociated. Mutations in this gene may be associated with hereditary nonpolyposis colon cancer, colorectal cancer, and endometrial cancer. Transcripts variants encoding different isoforms have been described. [provided by RefSeq, Jul 2013]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 8bp deletion in a coding exon of MSH6. |
| Description | 8bp deletion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | CCAAGATGGAGGGTTACCCC |
| PCR Primer |
Forward: TGGCAGTAGTGACTCTTACCTGTAT Reverse: AATGCCAGAAGACTTGGAATTGTTT |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.