Online Inquiry
MSH5 Knockout Cell Line
SPL-02170
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 11bp deletion |
| Target Information | |
|---|---|
| Target Name | MSH5 |
| Gene Abbr. | MSH5 |
| Gene ID | 4439 |
| Full Name | mutS homolog 5 |
| Alias | G7, MUTSH5, NG23, POF13 |
| Species | Human |
| Genomic Locus | chr6:31742897 |
| Transcript | NM_002441 |
| WT Expression Level | 15.46 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | This gene encodes a member of the mutS family of proteins that are involved in DNA mismatch repair and meiotic recombination. This protein is similar to a Saccharomyces cerevisiae protein that participates in segregation fidelity and crossing-over events during meiosis. This protein plays a role in promoting ionizing radiation-induced apoptosis. This protein forms hetero-oligomers with another member of this family, mutS homolog 4. Polymorphisms in this gene have been linked to various human diseases, including IgA deficiency, common variable immunodeficiency, and premature ovarian failure. Alternative splicing results multiple transcript variants. Read-through transcription also exists between this gene and the downstream chromosome 6 open reading frame 26 (C6orf26) gene. [provided by RefSeq, Feb 2011]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 11bp deletion in a coding exon of MSH5. |
| Description | 11bp deletion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | GCACTCGTAACAACAGACTG |
| PCR Primer |
Forward: ATTTCAGGTCTTTTAGGCTCTCTGT Reverse: GAAATGTTTTTGAGAAGGAGAGGGG |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.