MSH3 Knockout Cell Line - CD BioSciences

service-banner

MSH3 Knockout Cell Line

MSH3 Knockout Cell Line

SPL-02168

Size Price
1 Unit Online Inquiry
Description
4bp insertion
Target Information
Target Name MSH3
Gene Abbr. MSH3
Gene ID 4437
Full Name mutS homolog 3
Alias DUP, FAP4, MRP1
Species Human
Genomic Locus chr5:80670194
Transcript NM_002439
WT Expression Level 7.36 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing)
Introduction The protein encoded by this gene forms a heterodimer with MSH2 to form MutS beta, part of the post-replicative DNA mismatch repair system. MutS beta initiates mismatch repair by binding to a mismatch and then forming a complex with MutL alpha heterodimer. This gene contains a polymorphic 9 bp tandem repeat sequence in the first exon. The repeat is present 6 times in the reference genome sequence and 3-7 repeats have been reported. Defects in this gene are a cause of susceptibility to endometrial cancer. [provided by RefSeq, Mar 2011].
Product Details
Cell Line Model HAP1
Genotype HAP1 cell line, edited by CRISPR/Cas to contain a 4bp insertion in a coding exon of MSH3.
Description 4bp insertion
Parental Cell Line C631
Guide RNA Sequence TAGCGGCGTATAGATGCTTT
PCR Primer Forward: CACTAAGTGTTAGCTTTTTGCCAGA
Reverse: AAAAGACGACTTACCTCTGCATCTT
Handling Specifications
Revival Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish.
Culture Medium IMDM + 10% FCS
Growth Properties Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20.
Freeze Medium IMDM + 20% FCS + 10% DMSO
Biosafety Level BSL-1
Disclaimer This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.