Online Inquiry
MS4A2 Knockout Cell Line
SPL-02161
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 10bp deletion |
| Target Information | |
|---|---|
| Target Name | MS4A2 |
| Gene Abbr. | MS4A2 |
| Gene ID | 2206 |
| Full Name | membrane spanning 4-domains A2 |
| Alias | APY, ATOPY, FCER1B, FCERI, IGEL |
| Species | Human |
| Genomic Locus | chr11:60089737 |
| Transcript | NM_000139 |
| WT Expression Level | 5.18 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | The allergic response involves the binding of allergen to receptor-bound IgE followed by cell activation and the release of mediators responsible for the manifestations of allergy. The IgE-receptor, a tetramer composed of an alpha, beta, and 2 disulfide-linked gamma chains, is found on the surface of mast cells and basophils. This gene encodes the beta subunit of the high affinity IgE receptor which is a member of the membrane-spanning 4A gene family. Members of this nascent protein family are characterized by common structural features and similar intron/exon splice boundaries and display unique expression patterns among hematopoietic cells and nonlymphoid tissues. This family member is localized to 11q12, among a cluster of membrane-spanning 4A gene family members. Alternative splicing results in multiple transcript variants encoding distinct proteins. Additional transcript variants have been described but require experimental validation. [provided by RefSeq, Mar 2012]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 10bp deletion in a coding exon of MS4A2. |
| Description | 10bp deletion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | TTCAGGCAGACTATTGAAGT |
| PCR Primer |
Forward: GATGCTCTGAGCTTTAGTTTCTTGG Reverse: CTCTCATGAATCCAAGTGGGAAAAC |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.