MOK Knockout Cell Line - CD BioSciences

service-banner

MOK Knockout Cell Line

MOK Knockout Cell Line

SPL-02153

Size Price
1 Unit Online Inquiry
Description
8bp deletion
Target Information
Target Name MOK
Gene Abbr. MOK
Gene ID 5891
Full Name MOK protein kinase
Alias RAGE, RAGE-1, RAGE1, STK30
Species Human
Genomic Locus chr14:102250965
Transcript NM_014226
WT Expression Level 13.95 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing)
Introduction This gene belongs to the MAP kinase superfamily. The gene was found to be regulated by caudal type transcription factor 2 (Cdx2) protein. The encoded protein, which is localized to epithelial cells in the intestinal crypt, may play a role in growth arrest and differentiation of cells of upper crypt and lower villus regions. Multiple alternatively spliced transcript variants encoding different isoforms have been observed for this gene. [provided by RefSeq, Dec 2012].
Product Details
Cell Line Model HAP1
Genotype HAP1 cell line, edited by CRISPR/Cas to contain a 8bp deletion in a coding exon of MOK.
Description 8bp deletion
Parental Cell Line C631
Guide RNA Sequence GTCCTGAAATTAGGGGACTT
PCR Primer Forward: TGTAAAACGACGGCCAGCAGAATGACCATGACATCTGGATTG
Reverse: GGTTAACCAGTTTCCAAACCTGTAG
Handling Specifications
Revival Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish.
Culture Medium IMDM + 10% FCS
Growth Properties Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20.
Freeze Medium IMDM + 20% FCS + 10% DMSO
Biosafety Level BSL-1
Disclaimer This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.