Mmp9 cDNA ORF Clone, Mouse, N-FLAG tag - CD BioSciences

service-banner

Mmp9 cDNA ORF Clone, Mouse, N-FLAG tag

Mmp9 cDNA ORF Clone, Mouse, N-FLAG tag

SPD-10477

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Mouse matrix metallopeptidase 9 with N terminal Flag tag.
Target Information
Species Mouse
Target Name MMP-9
Gene Abbr. Mmp9
Gene ID 17395
Full Name matrix metallopeptidase 9
Alias AW743869, B/MMP, B/MMP9, Clg4, Clg4b
Introduction The matrix metalloproteinases (MMPs) are a family of proteases that target many extracellular proteins including other proteases, growth factors, cell surface receptors, and adhesion molecules. Among the family members, MMP-2, MMP-3, MMP-7, and MMP-9 have been characterized as important factors for normal tissue remodeling during embryonic development, wound healing, tumor invasion, angiogenesis, carcinogenesis, and apoptosis. Research studies have shown that MMP activity correlates with cancer development. One mechanism of MMP regulation is transcriptional. Once synthesized, MMP exists as a latent proenzyme. Maximum MMP activity requires proteolytic cleavage to generate active MMPs by releasing the inhibitory propeptide domain from the full length protein.
Product Details
Description Full length Clone DNA of Mouse matrix metallopeptidase 9 with N terminal Flag tag.
NCBI Ref Seq NM_013599.2
RefSeq ORF Size 2193 bp
Sequence Information Identical with the Gene Bank Ref. ID sequence except for the point mutations: 864G/A, 1992C/T not causing the amino acid variation.
Vector pCMV3-SP-N-FLAG
Promoter Enhanced CMV promoter
Tag Sequence FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Restriction Sites KpnI + XbaI (6kb + 2.22kb)
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.