MMP9 cDNA ORF Clone, Human, untagged - CD BioSciences

service-banner

MMP9 cDNA ORF Clone, Human, untagged

MMP9 cDNA ORF Clone, Human, untagged

SPD-10491

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Human matrix metallopeptidase 9 (gelatinase B, 92kDa gelatinase, 92kDa type I V collagenase).
Target Information
Species Human
Target Name MMP-9
Gene Abbr. MMP9
Gene ID 4318
Full Name matrix metallopeptidase 9
Alias CLG4B, GELB, MANDP2, MMP-9
Introduction The matrix metalloproteinases (MMPs) are a family of proteases that target many extracellular proteins including other proteases, growth factors, cell surface receptors, and adhesion molecules. Among the family members, MMP-2, MMP-3, MMP-7, and MMP-9 have been characterized as important factors for normal tissue remodeling during embryonic development, wound healing, tumor invasion, angiogenesis, carcinogenesis, and apoptosis. Research studies have shown that MMP activity correlates with cancer development. One mechanism of MMP regulation is transcriptional. Once synthesized, MMP exists as a latent proenzyme. Maximum MMP activity requires proteolytic cleavage to generate active MMPs by releasing the inhibitory propeptide domain from the full length protein.
Product Details
Description Full length Clone DNA of Human matrix metallopeptidase 9 (gelatinase B, 92kDa gelatinase, 92kDa type I V collagenase).
NCBI Ref Seq NM_004994.2
RefSeq ORF Size 2124 bp
Sequence Information Identical with the Gene Bank Ref. ID sequence except for the point mutations 2082 G/A not causing the amino acid variation.
Vector pCMV3-untagged
Promoter Enhanced CMV promoter
Restriction Sites KpnI + XbaI (6.1kb + 2.12kb)
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Ampicillin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.