Online Inquiry
MMP3 cDNA ORF Clone, Human, C-His tag
SPD-10453
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| Full length Clone DNA of Human matrix metallopeptidase 3 (stromelysin 1, progelatinase) with C terminal His tag. |
| Target Information | |
|---|---|
| Species | Human |
| Target Name | MMP-3 |
| Gene Abbr. | MMP3 |
| Gene ID | 4314 |
| Full Name | matrix metallopeptidase 3 |
| Alias | CHDS6, MMP-3, SL-1, STMY, STMY1 |
| Introduction | The matrix metalloproteinases (MMPs) are a family of proteases that target many extracellular proteins including other proteases, growth factors, cell surface receptors, and adhesion molecules. Among the family members, MMP-2, MMP-3, MMP-7, and MMP-9 have been characterized as important factors for normal tissue remodeling during embryonic development, wound healing, tumor invasion, angiogenesis, carcinogenesis, and apoptosis. Research studies have shown that MMP activity correlates with cancer development. One mechanism of MMP regulation is transcriptional. Once synthesized, MMP exists as a latent proenzyme. Maximum MMP activity requires proteolytic cleavage to generate active MMPs by releasing the inhibitory propeptide domain from the full length protein. |
| Product Details | |
|---|---|
| Description | Full length Clone DNA of Human matrix metallopeptidase 3 (stromelysin 1, progelatinase) with C terminal His tag. |
| NCBI Ref Seq | NM_002422.3 |
| RefSeq ORF Size | 1479 bp |
| Sequence Information | Identical with the Gene Bank Ref. ID sequence except for the point mutations: 288T/C,306C/G,1086T/C not causing the amino acid variation. |
| Vector | pCMV3-C-His |
| Promoter | Enhanced CMV promoter |
| Tag Sequence | His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC |
| Restriction Sites | KpnI (two restriction sites) + NotI (6kb + 0.83kb + 0.67kb) |
| Quality Control | The plasmid is confirmed by full-length sequencing. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
| Usage | |
|---|---|
| Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
| Antibiotic in E.coli | Kanamycin |
| Antibiotic in Mammalian cell | Hygromycin |
| Application | Stable or Transient mammalian expression |
| Shipping | Each tube contains lyophilized plasmid. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.