Online Inquiry
MMP25 Knockout Cell Line
SPL-02144
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 8bp deletion |
| Target Information | |
|---|---|
| Target Name | MMP-25 |
| Gene Abbr. | MMP25 |
| Gene ID | 64386 |
| Full Name | matrix metallopeptidase 25 |
| Alias | MMP-25, MMP20, MMP20A, MMPL1, MT-MMP 6 |
| Species | Human |
| Genomic Locus | chr16:3050097 |
| Transcript | NM_022468 |
| WT Expression Level | 0.81 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | Proteins of the matrix metalloproteinase (MMP) family are involved in the breakdown of extracellular matrix in normal physiological processes, such as embryonic development, reproduction, and tissue remodeling, as well as in disease processes, such as arthritis and metastasis. Most MMPs are secreted as inactive proproteins which are activated when cleaved by extracellular proteinases. However, the protein encoded by this gene is a member of the membrane-type MMP (MT-MMP) subfamily, attached to the plasma membrane via a glycosylphosphatidyl inositol anchor. In response to bacterial infection or inflammation, the encoded protein is thought to inactivate alpha-1 proteinase inhibitor, a major tissue protectant against proteolytic enzymes released by activated neutrophils, facilitating the transendothelial migration of neutrophils to inflammatory sites. The encoded protein may also play a role in tumor invasion and metastasis through activation of MMP2. The gene has previously been referred to as MMP20 but has been renamed MMP25. [provided by RefSeq, Jul 2008]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 8bp deletion in a coding exon of MMP25. |
| Description | 8bp deletion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | CGCTGCCGCTCAGAGCGTAC |
| PCR Primer |
Forward: CTATGATTAAGGCAGGCTCTCCTAT Reverse: ATCAGGGCATAGCTCATGAGGAC |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.