MMP24 Knockout Cell Line - CD BioSciences

service-banner

MMP24 Knockout Cell Line

MMP24 Knockout Cell Line

SPL-02141

Size Price
1 Unit Online Inquiry
Description
1bp insertion
Target Information
Target Name MMP-24
Gene Abbr. MMP24
Gene ID 10893
Full Name matrix metallopeptidase 24
Alias MMP-24, MMP25, MT-MMP 5, MT-MMP5, MT5-MMP
Species Human
Genomic Locus chr20:35246928
Transcript NM_006690
WT Expression Level 5.18 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing)
Introduction This gene encodes a member of the peptidase M10 family of matrix metalloproteinases (MMPs). Proteins in this family are involved in the breakdown of extracellular matrix in normal physiological processes, such as embryonic development, reproduction, and tissue remodeling, as well as in disease processes, such as arthritis and metastasis. The encoded preproprotein is proteolytically processed to generate the mature protease. Unlike most MMPs, which are secreted, this protease is a member of the membrane-type MMP (MT-MMP) subfamily, contains a transmembrane domain and is expressed at the cell surface. Substrates of this protease include the proteins cadherin 2 and matrix metallopeptidase 2 (also known as 72 kDa type IV collagenase). [provided by RefSeq, Feb 2016].
Product Details
Cell Line Model HAP1
Genotype HAP1 cell line, edited by CRISPR/Cas to contain a 1bp insertion in a coding exon of MMP24.
Description 1bp insertion
Parental Cell Line C631
Guide RNA Sequence CCACTATGCAGCAGTTTTAC
PCR Primer Forward: GTGAAGGAAAAAGAACTCAGAGCAT
Reverse: ATAAAAGATAGGAAGGGAGGATGGG
Handling Specifications
Revival Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish.
Culture Medium IMDM + 10% FCS
Growth Properties Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20.
Freeze Medium IMDM + 20% FCS + 10% DMSO
Biosafety Level BSL-1
Disclaimer This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.