Online Inquiry
MMP24 Knockout Cell Line
SPL-02140
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 1bp deletion |
| Target Information | |
|---|---|
| Target Name | MMP-24 |
| Gene Abbr. | MMP24 |
| Gene ID | 10893 |
| Full Name | matrix metallopeptidase 24 |
| Alias | MMP-24, MMP25, MT-MMP 5, MT-MMP5, MT5-MMP |
| Species | Human |
| Genomic Locus | chr20:35246928 |
| Transcript | NM_006690 |
| WT Expression Level | 5.18 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | This gene encodes a member of the peptidase M10 family of matrix metalloproteinases (MMPs). Proteins in this family are involved in the breakdown of extracellular matrix in normal physiological processes, such as embryonic development, reproduction, and tissue remodeling, as well as in disease processes, such as arthritis and metastasis. The encoded preproprotein is proteolytically processed to generate the mature protease. Unlike most MMPs, which are secreted, this protease is a member of the membrane-type MMP (MT-MMP) subfamily, contains a transmembrane domain and is expressed at the cell surface. Substrates of this protease include the proteins cadherin 2 and matrix metallopeptidase 2 (also known as 72 kDa type IV collagenase). [provided by RefSeq, Feb 2016]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 1bp deletion in a coding exon of MMP24. |
| Description | 1bp deletion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | CCACTATGCAGCAGTTTTAC |
| PCR Primer |
Forward: GTGAAGGAAAAAGAACTCAGAGCAT Reverse: ATAAAAGATAGGAAGGGAGGATGGG |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.