MMP17 Knockout Cell Line - CD BioSciences

service-banner

MMP17 Knockout Cell Line

MMP17 Knockout Cell Line

SPL-02139

Size Price
1 Unit Online Inquiry
Description
26bp deletion
Target Information
Target Name MMP-17
Gene Abbr. MMP17
Gene ID 4326
Full Name matrix metallopeptidase 17
Alias MMP-17, MT4-MMP, MT4MMP, MTMMP4
Species Human
Genomic Locus chr12:131838225
Transcript NM_016155
WT Expression Level 17.18 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing)
Introduction This gene encodes a member of the peptidase M10 family and membrane-type subfamily of matrix metalloproteinases (MMPs). Proteins in this family are involved in the breakdown of extracellular matrix in normal physiological processes, such as embryonic development, reproduction, and tissue remodeling, as well as in disease processes, such as arthritis and metastasis. Members of this subfamily contain a transmembrane domain suggesting that these proteins are expressed at the cell surface rather than secreted. The encoded preproprotein is proteolytically processed to generate the mature protease. This protein is unique among the membrane-type matrix metalloproteinases in that it is anchored to the cell membrane via a glycosylphosphatidylinositol (GPI) anchor. Elevated expression of the encoded protein has been observed in osteoarthritis and multiple human cancers. [provided by RefSeq, Jan 2016].
Product Details
Cell Line Model HAP1
Genotype HAP1 cell line, edited by CRISPR/Cas to contain a 26bp deletion in a coding exon of MMP17.
Description 26bp deletion
Parental Cell Line C631
Guide RNA Sequence CCTGTTGTGGGGTCAGCCGG
PCR Primer Forward: TTTATTAAGACACTTTTCCGGCAGC
Reverse: TAAGACGGGACTGTGCCTGAT
Handling Specifications
Revival Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish.
Culture Medium IMDM + 10% FCS
Growth Properties Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20.
Freeze Medium IMDM + 20% FCS + 10% DMSO
Biosafety Level BSL-1
Disclaimer This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.