Online Inquiry
MMP17 Knockout Cell Line
SPL-02139
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 26bp deletion |
| Target Information | |
|---|---|
| Target Name | MMP-17 |
| Gene Abbr. | MMP17 |
| Gene ID | 4326 |
| Full Name | matrix metallopeptidase 17 |
| Alias | MMP-17, MT4-MMP, MT4MMP, MTMMP4 |
| Species | Human |
| Genomic Locus | chr12:131838225 |
| Transcript | NM_016155 |
| WT Expression Level | 17.18 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | This gene encodes a member of the peptidase M10 family and membrane-type subfamily of matrix metalloproteinases (MMPs). Proteins in this family are involved in the breakdown of extracellular matrix in normal physiological processes, such as embryonic development, reproduction, and tissue remodeling, as well as in disease processes, such as arthritis and metastasis. Members of this subfamily contain a transmembrane domain suggesting that these proteins are expressed at the cell surface rather than secreted. The encoded preproprotein is proteolytically processed to generate the mature protease. This protein is unique among the membrane-type matrix metalloproteinases in that it is anchored to the cell membrane via a glycosylphosphatidylinositol (GPI) anchor. Elevated expression of the encoded protein has been observed in osteoarthritis and multiple human cancers. [provided by RefSeq, Jan 2016]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 26bp deletion in a coding exon of MMP17. |
| Description | 26bp deletion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | CCTGTTGTGGGGTCAGCCGG |
| PCR Primer |
Forward: TTTATTAAGACACTTTTCCGGCAGC Reverse: TAAGACGGGACTGTGCCTGAT |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.