MMP16 Knockout Cell Line - CD BioSciences

service-banner

MMP16 Knockout Cell Line

MMP16 Knockout Cell Line

SPL-02136

Size Price
1 Unit Online Inquiry
Description
17bp deletion
Target Information
Target Name MMP-16
Gene Abbr. MMP16
Gene ID 4325
Full Name matrix metallopeptidase 16
Alias C8orf57, MMP-X2, MT-MMP2, MT-MMP3, MT3-MMP
Species Human
Genomic Locus chr8:88197257
Transcript NM_005941
WT Expression Level 3.57 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing)
Introduction Proteins of the matrix metalloproteinase (MMP) family are involved in the breakdown of extracellular matrix in normal physiological processes, such as embryonic development, reproduction, and tissue remodeling, as well as in disease processes, such as arthritis and metastasis. Most MMP's are secreted as inactive proproteins which are activated when cleaved by extracellular proteinases. The encoded protein activates MMP2 by cleavage. This gene was once referred to as MT-MMP2, but was renamed as MT-MMP3 or MMP16. [provided by RefSeq, Oct 2010].
Product Details
Cell Line Model HAP1
Genotype HAP1 cell line, edited by CRISPR/Cas to contain a 17bp deletion in a coding exon of MMP16.
Description 17bp deletion
Parental Cell Line C631
Guide RNA Sequence GACATTCTGGGGTCAGTCGG
PCR Primer Forward: CAAGGACCAAAAAGAAAGGAGGATG
Reverse: TGTCAAAAAGATCCATAACAGTCGC
Handling Specifications
Revival Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish.
Culture Medium IMDM + 10% FCS
Growth Properties Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20.
Freeze Medium IMDM + 20% FCS + 10% DMSO
Biosafety Level BSL-1
Disclaimer This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.