Online Inquiry
MMP16 Knockout Cell Line
SPL-02136
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 17bp deletion |
| Target Information | |
|---|---|
| Target Name | MMP-16 |
| Gene Abbr. | MMP16 |
| Gene ID | 4325 |
| Full Name | matrix metallopeptidase 16 |
| Alias | C8orf57, MMP-X2, MT-MMP2, MT-MMP3, MT3-MMP |
| Species | Human |
| Genomic Locus | chr8:88197257 |
| Transcript | NM_005941 |
| WT Expression Level | 3.57 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | Proteins of the matrix metalloproteinase (MMP) family are involved in the breakdown of extracellular matrix in normal physiological processes, such as embryonic development, reproduction, and tissue remodeling, as well as in disease processes, such as arthritis and metastasis. Most MMP's are secreted as inactive proproteins which are activated when cleaved by extracellular proteinases. The encoded protein activates MMP2 by cleavage. This gene was once referred to as MT-MMP2, but was renamed as MT-MMP3 or MMP16. [provided by RefSeq, Oct 2010]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 17bp deletion in a coding exon of MMP16. |
| Description | 17bp deletion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | GACATTCTGGGGTCAGTCGG |
| PCR Primer |
Forward: CAAGGACCAAAAAGAAAGGAGGATG Reverse: TGTCAAAAAGATCCATAACAGTCGC |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.