MMP13 cDNA ORF Clone, Human, N-HA tag - CD BioSciences

service-banner

MMP13 cDNA ORF Clone, Human, N-HA tag

MMP13 cDNA ORF Clone, Human, N-HA tag

SPD-10450

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Human matrix metallopeptidase 13 (collagenase 3) with N terminal HA tag.
Target Information
Species Human
Target Name MMP-13
Gene Abbr. MMP13
Gene ID 4322
Full Name matrix metallopeptidase 13
Alias CLG3, MANDP1, MDST, MMP-13
Introduction MMP-13 (collagenase 3) belongs to the matrix metalloproteinase (MMP) superfamily of enzymes that targets many extracellular proteins, including other proteases, growth factors, cell surface receptors, and adhesion molecules. MMP-13 is a member of a subgroup of collagenases (including MMP-1, MMP-8, and MMP-18) that play an even more important function targeting fibrillar collagen. MMP-13 is synthesized as a latent proenzyme, and proteolytic removal of the inhibitory propeptide domain is required for enzyme activation. MMP-13 protein levels are regulated at the transcriptional level, via specific transcription factors and via promoter DNA methylation. MMP-13 preferentially cleaves Type II collagen, and research studies have shown that aberrant upregulation of MMP-13 activity can lead to cartilage loss and osteoarthritis. In addition, MMP-13 has been shown to promote cancer development, in part through enhancing tumor angiogenesis and metastases, suggesting that collagenase activity may serve as a useful marker of tumor progression.
Product Details
Description Full length Clone DNA of Human matrix metallopeptidase 13 (collagenase 3) with N terminal HA tag.
NCBI Ref Seq NM_002427
RefSeq ORF Size 1416 bp
Vector pCMV3-SP-N-HA
Promoter Enhanced CMV promoter
Tag Sequence HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.