Online Inquiry
MMP13 cDNA ORF Clone, Human, N-FLAG tag
SPD-10447
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
Full length Clone DNA of Human matrix metallopeptidase 13 (collagenase 3) with N terminal Flag tag. |
Target Information | |
---|---|
Species | Human |
Target Name | MMP-13 |
Gene Abbr. | MMP13 |
Gene ID | 4322 |
Full Name | matrix metallopeptidase 13 |
Alias | CLG3, MANDP1, MDST, MMP-13 |
Introduction | MMP-13 (collagenase 3) belongs to the matrix metalloproteinase (MMP) superfamily of enzymes that targets many extracellular proteins, including other proteases, growth factors, cell surface receptors, and adhesion molecules. MMP-13 is a member of a subgroup of collagenases (including MMP-1, MMP-8, and MMP-18) that play an even more important function targeting fibrillar collagen. MMP-13 is synthesized as a latent proenzyme, and proteolytic removal of the inhibitory propeptide domain is required for enzyme activation. MMP-13 protein levels are regulated at the transcriptional level, via specific transcription factors and via promoter DNA methylation. MMP-13 preferentially cleaves Type II collagen, and research studies have shown that aberrant upregulation of MMP-13 activity can lead to cartilage loss and osteoarthritis. In addition, MMP-13 has been shown to promote cancer development, in part through enhancing tumor angiogenesis and metastases, suggesting that collagenase activity may serve as a useful marker of tumor progression. |
Product Details | |
---|---|
Description | Full length Clone DNA of Human matrix metallopeptidase 13 (collagenase 3) with N terminal Flag tag. |
NCBI Ref Seq | NM_002427 |
RefSeq ORF Size | 1416 bp |
Sequence Information | Identical with the Gene Bank Ref. ID sequence. |
Vector | pCMV3-SP-N-FLAG |
Promoter | Enhanced CMV promoter |
Tag Sequence | FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG |
Restriction Sites | KpnI + XbaI (6kb + 1.45kb) |
Quality Control | The plasmid is confirmed by full-length sequencing. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
Usage | |
---|---|
Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
Antibiotic in E.coli | Kanamycin |
Antibiotic in Mammalian cell | Hygromycin |
Application | Stable or Transient mammalian expression |
Shipping | Each tube contains lyophilized plasmid. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.