MMP1 cDNA ORF Clone, Human, untagged - CD BioSciences

service-banner

MMP1 cDNA ORF Clone, Human, untagged

MMP1 cDNA ORF Clone, Human, untagged

SPD-10430

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Human matrix metallopeptidase 1 (interstitial collagenase).
Target Information
Species Human
Target Name MMP-1
Gene Abbr. MMP1
Gene ID 4312
Full Name matrix metallopeptidase 1
Alias CLG, CLGN
Introduction The matrix metalloproteinase (MMP) family of proteases is a group of zinc-dependent enzymes that target extracellular proteins, including growth factors, cell surface receptors, adhesion molecules, matrix structural proteins, and other proteases. Within this family, MMP1, MMP8, and MMP13 have been characterized as a collagenase sub-family of MMPs targeting fibrillar collagen (collagen type I, II, and III) for degradation. In addition to collagen, MMP1 also has activity toward a broad array of other ECM proteins such as fibronectin, gelatin, aggrecan (etc.), as well as growth factors, chemokines, and cytokines. MMP1 is widely involved in tissue remodeling during wound healing, tumor growth, invasion and metastasis, and arthritis.
Product Details
Description Full length Clone DNA of Human matrix metallopeptidase 1 (interstitial collagenase).
NCBI Ref Seq NM_002421.3
RefSeq ORF Size 1410 bp
Sequence Information Identical with the Gene Bank Ref. ID sequence except for the point mutations: 648 A>G not causing the amino acid variation.
Vector pCMV3-untagged
Promoter Enhanced CMV promoter
Restriction Sites KpnI + NotI (6.1kb + 1.41kb)
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Ampicillin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.