Online Inquiry
MMP1 cDNA ORF Clone, Human, C-HA tag
SPD-10424
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
Full length Clone DNA of Human matrix metallopeptidase 1 (interstitial collagenase) with C terminal HA tag. |
Target Information | |
---|---|
Species | Human |
Target Name | MMP-1 |
Gene Abbr. | MMP1 |
Gene ID | 4312 |
Full Name | matrix metallopeptidase 1 |
Alias | CLG, CLGN |
Introduction | The matrix metalloproteinase (MMP) family of proteases is a group of zinc-dependent enzymes that target extracellular proteins, including growth factors, cell surface receptors, adhesion molecules, matrix structural proteins, and other proteases. Within this family, MMP1, MMP8, and MMP13 have been characterized as a collagenase sub-family of MMPs targeting fibrillar collagen (collagen type I, II, and III) for degradation. In addition to collagen, MMP1 also has activity toward a broad array of other ECM proteins such as fibronectin, gelatin, aggrecan (etc.), as well as growth factors, chemokines, and cytokines. MMP1 is widely involved in tissue remodeling during wound healing, tumor growth, invasion and metastasis, and arthritis. |
Product Details | |
---|---|
Description | Full length Clone DNA of Human matrix metallopeptidase 1 (interstitial collagenase) with C terminal HA tag. |
NCBI Ref Seq | NM_002421.3 |
RefSeq ORF Size | 1452 bp |
Sequence Information | Identical with the Gene Bank Ref. ID sequence except for the point mutations: 648A/G not causing the amino acid variation. |
Vector | pCMV3-C-HA |
Promoter | Enhanced CMV promoter |
Tag Sequence | HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC |
Restriction Sites | KpnI + NotI (6kb + 1.45kb) |
Quality Control | The plasmid is confirmed by full-length sequencing. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
Usage | |
---|---|
Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
Antibiotic in E.coli | Kanamycin |
Antibiotic in Mammalian cell | Hygromycin |
Application | Stable or Transient mammalian expression |
Shipping | Each tube contains lyophilized plasmid. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.