Online Inquiry
MME Knockout Cell Line
SPL-02129
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 16bp deletion |
| Target Information | |
|---|---|
| Target Name | MME |
| Gene Abbr. | MME |
| Gene ID | 4311 |
| Full Name | membrane metalloendopeptidase |
| Alias | CALLA, CD10, CMT2T, NEP, SCA43 |
| Species | Human |
| Genomic Locus | chr3:155115089 |
| Transcript | NM_000902 |
| WT Expression Level | 8.95 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | This gene encodes a common acute lymphocytic leukemia antigen that is an important cell surface marker in the diagnosis of human acute lymphocytic leukemia (ALL). This protein is present on leukemic cells of pre-B phenotype, which represent 85% of cases of ALL. This protein is not restricted to leukemic cells, however, and is found on a variety of normal tissues. It is a glycoprotein that is particularly abundant in kidney, where it is present on the brush border of proximal tubules and on glomerular epithelium. The protein is a neutral endopeptidase that cleaves peptides at the amino side of hydrophobic residues and inactivates several peptide hormones including glucagon, enkephalins, substance P, neurotensin, oxytocin, and bradykinin. This gene, which encodes a 100-kD type II transmembrane glycoprotein, exists in a single copy of greater than 45 kb. The 5' untranslated region of this gene is alternatively spliced, resulting in four separate mRNA transcripts. The coding region is not affected by alternative splicing. [provided by RefSeq, Jul 2008]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 16bp deletion in a coding exon of MME. |
| Description | 16bp deletion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | CCCGAGACCAGCTCCCGTTA |
| PCR Primer |
Forward: GCCTTTTTCTCCTTTTAAGCCTCTT Reverse: GTGACATTCCTTGTAATGGCTAACA |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.