Online Inquiry
MLST8 cDNA ORF Clone, Human, untagged
SPD-06254
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| Full length Clone DNA of Human MTOR associated protein, LST8 homolog. |
| Target Information | |
|---|---|
| Species | Human |
| Target Name | GβL |
| Gene Abbr. | MLST8 |
| Gene ID | 64223 |
| Full Name | MTOR associated protein, LST8 homolog |
| Alias | GBL, GbetaL, LST8, POP3, WAT1 |
| Introduction | Cell growth is a fundamental biological process whereby cells accumulate mass and increase in size. The mammalian Target of Rapamycin (mTOR) pathway regulates growth by coordinating energy and nutrient signals with growth factor-derived signals. mTOR is a large protein kinase with two different complexes. One complex contains mTOR, GβL, and raptor, which is a target of rapamycin. The other complex, insensitive to rapamycin, includes mTOR, GβL, and rictor. GβL associates with the kinase domain of mTOR and stimulates mTOR kinase activity. A reduction in GβL expression has been shown to decrease in vivo phosphorylation of S6K1. |
| Product Details | |
|---|---|
| Description | Full length Clone DNA of Human MTOR associated protein, LST8 homolog. |
| NCBI Ref Seq | XM_005255479.2 |
| RefSeq ORF Size | 999 bp |
| Sequence Information | Identical with the Gene Bank Ref. ID sequence. |
| Vector | pCMV3-untagged |
| Promoter | Enhanced CMV promoter |
| Restriction Sites | KpnI + XbaI (6kb + 1kb) |
| Quality Control | The plasmid is confirmed by full-length sequencing. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
| Usage | |
|---|---|
| Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
| Antibiotic in E.coli | Ampicillin |
| Antibiotic in Mammalian cell | Hygromycin |
| Application | Stable or Transient mammalian expression |
| Shipping | Each tube contains lyophilized plasmid. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.