MLC1 cDNA ORF Clone, Rhesus, untagged - CD BioSciences

service-banner

MLC1 cDNA ORF Clone, Rhesus, untagged

MLC1 cDNA ORF Clone, Rhesus, untagged

SPD-10389

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Rhesus megalencephalic leukoencephalopathy with subcortical cysts 1.
Target Information
Species Rhesus
Target Name MLC1
Gene Abbr. MLC1
Gene ID 715409
Full Name modulator of VRAC current 1
Product Details
Description Full length Clone DNA of Rhesus megalencephalic leukoencephalopathy with subcortical cysts 1.
NCBI Ref Seq NM_001261612.1
RefSeq ORF Size 1134 bp
Vector pCMV3-untagged
Promoter Enhanced CMV promoter
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Ampicillin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.