Mknk2 cDNA ORF Clone, Mouse, untagged - CD BioSciences

service-banner

Mknk2 cDNA ORF Clone, Mouse, untagged

Mknk2 cDNA ORF Clone, Mouse, untagged

SPD-10522

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Mouse MAP kinase-interacting serine/threonine kinase 2.
Target Information
Species Mouse
Target Name Mnk2
Gene Abbr. Mknk2
Gene ID 17347
Full Name MAP kinase-interacting serine/threonine kinase 2
Alias 2010016G11Rik, Gprk7, Mnk, Mnk2
Product Details
Description Full length Clone DNA of Mouse MAP kinase-interacting serine/threonine kinase 2.
NCBI Ref Seq NM_021462.4
RefSeq ORF Size 1380 bp
Vector pCMV3-untagged
Promoter Enhanced CMV promoter
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Ampicillin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.