Online Inquiry
MKNK1 Knockout Cell Line
SPL-02117
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 4bp deletion |
| Target Information | |
|---|---|
| Target Name | Mnk1 |
| Gene Abbr. | MKNK1 |
| Gene ID | 8569 |
| Full Name | MAPK interacting serine/threonine kinase 1 |
| Alias | MNK1 |
| Species | Human |
| Genomic Locus | chr1:46576621 |
| Transcript | NM_001135553 |
| WT Expression Level | 33.97 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | This gene encodes a Ser/Thr protein kinase that interacts with, and is activated by ERK1 and p38 mitogen-activated protein kinases, and thus may play a role in the response to environmental stress and cytokines. This kinase may also regulate transcription by phosphorylating eIF4E via interaction with the C-terminal region of eIF4G. Alternatively spliced transcript variants have been noted for this gene. [provided by RefSeq, Jan 2012]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 4bp deletion in a coding exon of MKNK1. |
| Description | 4bp deletion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | AGCAGGGCACAGTCGGAGTA |
| PCR Primer |
Forward: TCCTTTCTCTCCCTAACACTGAAAG Reverse: GACACTGGATTTGGACTGAGTGT |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.