Mknk1 cDNA ORF Clone, Mouse, N-FLAG tag - CD BioSciences

service-banner

Mknk1 cDNA ORF Clone, Mouse, N-FLAG tag

Mknk1 cDNA ORF Clone, Mouse, N-FLAG tag

SPD-10496

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Mouse MAP kinase-interacting serine/threonine kinase 1 with N terminal Flag tag.
Target Information
Species Mouse
Target Name Mnk1
Gene Abbr. Mknk1
Gene ID 17346
Full Name MAP kinase-interacting serine/threonine kinase 1
Alias 2410048M24Rik, Mnk, Mnk1
Introduction Mitogen-activated protein kinases (MAPKs) are activated by various extracellular signals and play crucial roles in regulating cell proliferation, differentiation, survival, and apoptosis. MAPK-interacting kinases (Mnks or MKNKs) are direct downstream substrates of MAPK and were first discovered independently by the work of Fukunaga and Hunter and Waskiewicz and Cooper. There are 2 Mnks in human, termed Mnk1 and Mnk2. Both Mnks possess a MAPK-binding domain that allows them to bind to and then to be phosphorylated by Erk and p38. The phosphorylation in the T-loop of Mnks stimulates their in vitro kinase activity toward a substrate, eukaryotic initiation factor-4E (eIF4E). eIF4E is a key component of the translational machinery mediating the initiation of translation, but how phosphorylation of eIF4E regulates translation initiation is still under investigation.
Product Details
Description Full length Clone DNA of Mouse MAP kinase-interacting serine/threonine kinase 1 with N terminal Flag tag.
NCBI Ref Seq NM_001285487.1
RefSeq ORF Size 1266 bp
Vector pCMV3-N-FLAG
Promoter Enhanced CMV promoter
Tag Sequence FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.