Online Inquiry
Mknk1 cDNA ORF Clone, Mouse, C-HA tag
SPD-10495
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| Full length Clone DNA of Mouse MAP kinase-interacting serine/threonine kinase 1 with C terminal HA tag. |
| Target Information | |
|---|---|
| Species | Mouse |
| Target Name | Mnk1 |
| Gene Abbr. | Mknk1 |
| Gene ID | 17346 |
| Full Name | MAP kinase-interacting serine/threonine kinase 1 |
| Alias | 2410048M24Rik, Mnk, Mnk1 |
| Introduction | Mitogen-activated protein kinases (MAPKs) are activated by various extracellular signals and play crucial roles in regulating cell proliferation, differentiation, survival, and apoptosis. MAPK-interacting kinases (Mnks or MKNKs) are direct downstream substrates of MAPK and were first discovered independently by the work of Fukunaga and Hunter and Waskiewicz and Cooper. There are 2 Mnks in human, termed Mnk1 and Mnk2. Both Mnks possess a MAPK-binding domain that allows them to bind to and then to be phosphorylated by Erk and p38. The phosphorylation in the T-loop of Mnks stimulates their in vitro kinase activity toward a substrate, eukaryotic initiation factor-4E (eIF4E). eIF4E is a key component of the translational machinery mediating the initiation of translation, but how phosphorylation of eIF4E regulates translation initiation is still under investigation. |
| Product Details | |
|---|---|
| Description | Full length Clone DNA of Mouse MAP kinase-interacting serine/threonine kinase 1 with C terminal HA tag. |
| NCBI Ref Seq | NM_001285487.1 |
| RefSeq ORF Size | 1266 bp |
| Vector | pCMV3-C-HA |
| Promoter | Enhanced CMV promoter |
| Tag Sequence | HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC |
| Quality Control | The plasmid is confirmed by full-length sequencing. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
| Usage | |
|---|---|
| Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
| Antibiotic in E.coli | Kanamycin |
| Antibiotic in Mammalian cell | Hygromycin |
| Application | Stable or Transient mammalian expression |
| Shipping | Each tube contains lyophilized plasmid. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.