MKNK1 cDNA ORF Clone, Human, N-FLAG tag - CD BioSciences

service-banner

MKNK1 cDNA ORF Clone, Human, N-FLAG tag

MKNK1 cDNA ORF Clone, Human, N-FLAG tag

SPD-10507

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Human MAP kinase interacting serine/threonine kinase 1, transcript variant 2 with N terminal Flag tag.
Target Information
Species Human
Target Name Mnk1
Gene Abbr. MKNK1
Gene ID 8569
Full Name MAPK interacting serine/threonine kinase 1
Alias MNK1
Introduction Mitogen-activated protein kinases (MAPKs) are activated by various extracellular signals and play crucial roles in regulating cell proliferation, differentiation, survival, and apoptosis. MAPK-interacting kinases (Mnks or MKNKs) are direct downstream substrates of MAPK and were first discovered independently by the work of Fukunaga and Hunter and Waskiewicz and Cooper. There are 2 Mnks in human, termed Mnk1 and Mnk2. Both Mnks possess a MAPK-binding domain that allows them to bind to and then to be phosphorylated by Erk and p38. The phosphorylation in the T-loop of Mnks stimulates their in vitro kinase activity toward a substrate, eukaryotic initiation factor-4E (eIF4E). eIF4E is a key component of the translational machinery mediating the initiation of translation, but how phosphorylation of eIF4E regulates translation initiation is still under investigation.
Product Details
Description Full length Clone DNA of Human MAP kinase interacting serine/threonine kinase 1, transcript variant 2 with N terminal Flag tag.
NCBI Ref Seq NM_198973.2
RefSeq ORF Size 1083 bp
Sequence Information Identical with the Gene Bank Ref. ID sequence except for the point mutations: 187C/T not causing the amino acid variation.
Vector pCMV3-N-FLAG
Promoter Enhanced CMV promoter
Tag Sequence FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Restriction Sites KpnI + XbaI (6kb + 1.08kb)
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.