Mitf cDNA ORF Clone, Mouse, N-His tag - CD BioSciences

service-banner

Mitf cDNA ORF Clone, Mouse, N-His tag

Mitf cDNA ORF Clone, Mouse, N-His tag

SPD-10343

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Mouse microphthalmia-associated transcription factor with N terminal His tag.
Target Information
Species Mouse
Target Name MITF
Gene Abbr. Mitf
Gene ID 17342
Full Name melanogenesis associated transcription factor
Alias BCC2, Bhlhe32, Gsfbcc, Gsfbcc2, Vitiligo
Introduction Microphthalmia-associated transcription factor (MITF) is a basic helix-loop-helix leucine zipper transcription factor that is most widely known for its roles in melanocyte, ophthalmic, and osteoclast development. In humans, MITF can function as a melanoma oncogene and mutations in the corresponding MITF gene are associated with Waardenburg syndrome type 2, an auditory-pigmentary syndrome characterized by developmental defects in cells derived from neural crest. At least 12 isoforms of MITF have been identified, which exhibit differential patterns of expression among cell and tissue types.
Product Details
Description Full length Clone DNA of Mouse microphthalmia-associated transcription factor with N terminal His tag.
NCBI Ref Seq NM_001178049.1
RefSeq ORF Size 1533 bp
Vector pCMV3-N-His
Promoter Enhanced CMV promoter
Tag Sequence His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.