Online Inquiry
Mitf cDNA ORF Clone, Mouse, C-HA tag
SPD-10341
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
Full length Clone DNA of Mouse microphthalmia-associated transcription factor with C terminal HA tag. |
Target Information | |
---|---|
Species | Mouse |
Target Name | MITF |
Gene Abbr. | Mitf |
Gene ID | 17342 |
Full Name | melanogenesis associated transcription factor |
Alias | BCC2, Bhlhe32, Gsfbcc, Gsfbcc2, Vitiligo |
Introduction | Microphthalmia-associated transcription factor (MITF) is a basic helix-loop-helix leucine zipper transcription factor that is most widely known for its roles in melanocyte, ophthalmic, and osteoclast development. In humans, MITF can function as a melanoma oncogene and mutations in the corresponding MITF gene are associated with Waardenburg syndrome type 2, an auditory-pigmentary syndrome characterized by developmental defects in cells derived from neural crest. At least 12 isoforms of MITF have been identified, which exhibit differential patterns of expression among cell and tissue types. |
Product Details | |
---|---|
Description | Full length Clone DNA of Mouse microphthalmia-associated transcription factor with C terminal HA tag. |
NCBI Ref Seq | NM_001178049.1 |
RefSeq ORF Size | 1533 bp |
Vector | pCMV3-C-HA |
Promoter | Enhanced CMV promoter |
Tag Sequence | HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC |
Quality Control | The plasmid is confirmed by full-length sequencing. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
Usage | |
---|---|
Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
Antibiotic in E.coli | Kanamycin |
Antibiotic in Mammalian cell | Hygromycin |
Application | Stable or Transient mammalian expression |
Shipping | Each tube contains lyophilized plasmid. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.