Online Inquiry
MITF cDNA ORF Clone, Human, untagged
SPD-10357
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| Full length Clone DNA of Human microphthalmia-associated transcription factor. |
| Target Information | |
|---|---|
| Species | Human |
| Target Name | MITF |
| Gene Abbr. | MITF |
| Gene ID | 4286 |
| Full Name | melanocyte inducing transcription factor |
| Alias | CMM8, COMMAD, MI, WS2, WS2A |
| Introduction | Microphthalmia-associated transcription factor (MITF) is a basic helix-loop-helix leucine zipper transcription factor that is most widely known for its roles in melanocyte, ophthalmic, and osteoclast development. In humans, MITF can function as a melanoma oncogene and mutations in the corresponding MITF gene are associated with Waardenburg syndrome type 2, an auditory-pigmentary syndrome characterized by developmental defects in cells derived from neural crest. At least 12 isoforms of MITF have been identified, which exhibit differential patterns of expression among cell and tissue types. |
| Product Details | |
|---|---|
| Description | Full length Clone DNA of Human microphthalmia-associated transcription factor. |
| NCBI Ref Seq | NM_198159.1 |
| RefSeq ORF Size | 1563 bp |
| Sequence Information | Identical with the Gene Bank Ref. ID sequence. |
| Vector | pCMV3-untagged |
| Promoter | Enhanced CMV promoter |
| Restriction Sites | KpnI + XbaI (6.1kb + 1.56kb) |
| Quality Control | The plasmid is confirmed by full-length sequencing. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
| Usage | |
|---|---|
| Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
| Antibiotic in E.coli | Ampicillin |
| Antibiotic in Mammalian cell | Hygromycin |
| Application | Stable or Transient mammalian expression |
| Shipping | Each tube contains lyophilized plasmid. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.