Online Inquiry
MINK1 Knockout Cell Line
SPL-02116
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 22bp deletion |
| Target Information | |
|---|---|
| Target Name | MAP4K6 |
| Gene Abbr. | MINK1 |
| Gene ID | 50488 |
| Full Name | misshapen like kinase 1 |
| Alias | B55, MAP4K6, MINK, YSK2, ZC3 |
| Species | Human |
| Genomic Locus | chr17:4885522 |
| Transcript | NM_170663 |
| WT Expression Level | 38.23 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | This gene encodes a serine/threonine kinase belonging to the germinal center kinase (GCK) family. The protein is structurally similar to the kinases that are related to NIK and may belong to a distinct subfamily of NIK-related kinases within the GCK family. Studies of the mouse homolog indicate an up-regulation of expression in the course of postnatal mouse cerebral development and activation of the cJun N-terminal kinase (JNK) and the p38 pathways. [provided by RefSeq, Mar 2016]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 22bp deletion in a coding exon of MINK1. |
| Description | 22bp deletion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | GCAGACGGAACACTTTCATT |
| PCR Primer |
Forward: TGTAAAACGACGGCCAGTGATGCTGTCCGTGATCCTTT Reverse: ATCTCGATGGCTGTGATTCC |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.