MGMT Knockout Cell Line - CD BioSciences

service-banner

MGMT Knockout Cell Line

MGMT Knockout Cell Line

SPL-02105

Size Price
1 Unit Online Inquiry
Description
2bp deletion
Target Information
Target Name MGMT
Gene Abbr. MGMT
Gene ID 4255
Full Name O-6-methylguanine-DNA methyltransferase
Species Human
Genomic Locus chr10:129536334
Transcript NM_002412
WT Expression Level 1.79 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing)
Introduction Alkylating agents are potent carcinogens that can result in cell death, mutation and cancer. The protein encoded by this gene is a DNA repair protein that is involved in cellular defense against mutagenesis and toxicity from alkylating agents. The protein catalyzes transfer of methyl groups from O(6)-alkylguanine and other methylated moieties of the DNA to its own molecule, which repairs the toxic lesions. Methylation of the genes promoter has been associated with several cancer types, including colorectal cancer, lung cancer, lymphoma and glioblastoma. [provided by RefSeq, Sep 2015].
Product Details
Cell Line Model HAP1
Genotype HAP1 cell line, edited by CRISPR/Cas to contain a 2bp deletion in a coding exon of MGMT.
Description 2bp deletion
Parental Cell Line C631
Guide RNA Sequence CTGCACGAAATAAAGCTCCT
PCR Primer Forward: CCAGCCTCTTACCTATACACTTTGT
Reverse: ATCAATGGAAAACATGCCGTTATCA
Handling Specifications
Revival Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish.
Culture Medium IMDM + 10% FCS
Growth Properties Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20.
Freeze Medium IMDM + 20% FCS + 10% DMSO
Biosafety Level BSL-1
Disclaimer This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.