Online Inquiry
MGAT2 Knockout Cell Line
SPL-02097
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 14bp deletion |
| Target Information | |
|---|---|
| Target Name | MGAT2 |
| Gene Abbr. | MGAT2 |
| Gene ID | 4247 |
| Full Name | alpha-1,6-mannosyl-glycoprotein 2-beta-N-acetylglucosaminyltransferase |
| Alias | CDG2A, CDGS2, GLCNACTII, GNT-II, GNT2 |
| Species | Human |
| Genomic Locus | chr14:49621384 |
| Transcript | NM_002408 |
| WT Expression Level | 21.36 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | The product of this gene is a Golgi enzyme catalyzing an essential step in the conversion of oligomannose to complex N-glycans. The enzyme has the typical glycosyltransferase domains: a short N-terminal cytoplasmic domain, a hydrophobic non-cleavable signal-anchor domain, and a C-terminal catalytic domain. Mutations in this gene may lead to carbohydrate-deficient glycoprotein syndrome, type II. The coding region of this gene is intronless. Transcript variants with a spliced 5' UTR may exist, but their biological validity has not been determined. [provided by RefSeq, Jul 2008]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 14bp deletion in a coding exon of MGAT2. |
| Description | 14bp deletion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | TTCGGCGTCCAGCAACGGTG |
| PCR Primer |
Forward: GAGACCATGAGGTTCCGCATCT Reverse: TCTGATCAAAGTTCAGCTGGTACAC |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.