Online Inquiry
MGAT1 Knockout Cell Line
SPL-02096
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
29bp deletion |
Target Information | |
---|---|
Target Name | MGAT1 |
Gene Abbr. | MGAT1 |
Gene ID | 4245 |
Full Name | alpha-1,3-mannosyl-glycoprotein 2-beta-N-acetylglucosaminyltransferase |
Alias | GLCNAC-TI, GLCT1, GLYT1, GNT-1, GNT-I |
Species | Human |
Genomic Locus | chr5:180792841 |
Transcript | NM_001114617 |
WT Expression Level | 16.67 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
Introduction | There are believed to be over 100 different glycosyltransferases involved in the synthesis of protein-bound and lipid-bound oligosaccharides. UDP-N-acetylglucosamine:alpha-3-D-mannoside beta-1,2-N-acetylglucosaminyltransferase I is a medial-Golgi enzyme essential for the synthesis of hybrid and complex N-glycans. The protein, encoded by a single exon, shows typical features of a type II transmembrane protein. The protein is believed to be essential for normal embryogenesis. Several variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]. |
Product Details | |
---|---|
Cell Line Model | HAP1 |
Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 29bp deletion in a coding exon of MGAT1. |
Description | 29bp deletion |
Parental Cell Line | C631 |
Guide RNA Sequence | CCCTCAGTCAGCGCTCTCGA |
PCR Primer |
Forward: CTAACGATGATGGGGAAGAGCTCAG Reverse: TTGCTTTCTCTCTCCTGTCTTTAGG |
Handling Specifications | |
---|---|
Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
Culture Medium | IMDM + 10% FCS |
Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
Freeze Medium | IMDM + 20% FCS + 10% DMSO |
Biosafety Level | BSL-1 |
Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.