Mettl1 cDNA ORF Clone, Rat, untagged - CD BioSciences

service-banner

Mettl1 cDNA ORF Clone, Rat, untagged

Mettl1 cDNA ORF Clone, Rat, untagged

SPD-10315

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Rat methyltransferase like 1.
Target Information
Species Rat
Target Name METTL1
Gene Abbr. Mettl1
Gene ID 679091
Full Name methyltransferase like 1
Product Details
Description Full length Clone DNA of Rat methyltransferase like 1.
NCBI Ref Seq XM_001054797.5
RefSeq ORF Size 804 bp
Vector pCMV3-untagged
Promoter Enhanced CMV promoter
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Ampicillin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.