METTL1 cDNA ORF Clone, Human, untagged - CD BioSciences

service-banner

METTL1 cDNA ORF Clone, Human, untagged

METTL1 cDNA ORF Clone, Human, untagged

SPD-10325

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Human methyltransferase like 1.
Target Information
Species Human
Target Name METTL1
Gene Abbr. METTL1
Gene ID 4234
Full Name methyltransferase like 1
Alias C12orf1, TRM8, TRMT8, YDL201w
Product Details
Description Full length Clone DNA of Human methyltransferase like 1.
NCBI Ref Seq NM_005371.5
RefSeq ORF Size 831 bp
Sequence Information Identical with the Gene Bank Ref. ID sequence.
Vector pCMV3-untagged
Promoter Enhanced CMV promoter
Restriction Sites KpnI + XbaI (6.1kb + 0.83kb)
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Ampicillin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.