Online Inquiry
MEF2C cDNA ORF Clone, Human, untagged
SPD-10213
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
Full length Clone DNA of Human myocyte enhancer factor 2C. |
Target Information | |
---|---|
Species | Human |
Target Name | MEF2C |
Gene Abbr. | MEF2C |
Gene ID | 4208 |
Full Name | myocyte enhancer factor 2C |
Alias | C5DELq14.3, DEL5q14.3 |
Introduction | This locus encodes a member of the MADS box transcription enhancer factor 2 (MEF2) family of proteins, which play a role in myogenesis. The encoded protein, MEF2 polypeptide C, has both trans-activating and DNA binding activities. This protein may play a role in maintaining the differentiated state of muscle cells. Mutations and deletions at this locus have been associated with severe mental retardation, stereotypic movements, epilepsy, and cerebral malformation. Alternatively spliced transcript variants have been described. [provided by RefSeq]. |
Product Details | |
---|---|
Description | Full length Clone DNA of Human myocyte enhancer factor 2C. |
NCBI Ref Seq | BC026341 |
RefSeq ORF Size | 1410 bp |
Vector | pCMV3-untagged |
Promoter | Enhanced CMV promoter |
Quality Control | The plasmid is confirmed by full-length sequencing. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
Usage | |
---|---|
Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
Antibiotic in E.coli | Ampicillin |
Antibiotic in Mammalian cell | Hygromycin |
Application | Stable or Transient mammalian expression |
Shipping | Each tube contains lyophilized plasmid. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.