MEF2C cDNA ORF Clone, Human, untagged - CD BioSciences

service-banner

MEF2C cDNA ORF Clone, Human, untagged

MEF2C cDNA ORF Clone, Human, untagged

SPD-10213

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Human myocyte enhancer factor 2C.
Target Information
Species Human
Target Name MEF2C
Gene Abbr. MEF2C
Gene ID 4208
Full Name myocyte enhancer factor 2C
Alias C5DELq14.3, DEL5q14.3
Introduction This locus encodes a member of the MADS box transcription enhancer factor 2 (MEF2) family of proteins, which play a role in myogenesis. The encoded protein, MEF2 polypeptide C, has both trans-activating and DNA binding activities. This protein may play a role in maintaining the differentiated state of muscle cells. Mutations and deletions at this locus have been associated with severe mental retardation, stereotypic movements, epilepsy, and cerebral malformation. Alternatively spliced transcript variants have been described. [provided by RefSeq].
Product Details
Description Full length Clone DNA of Human myocyte enhancer factor 2C.
NCBI Ref Seq BC026341
RefSeq ORF Size 1410 bp
Vector pCMV3-untagged
Promoter Enhanced CMV promoter
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Ampicillin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.