MEF2A cDNA ORF Clone, Human, N-HA tag - CD BioSciences

service-banner

MEF2A cDNA ORF Clone, Human, N-HA tag

MEF2A cDNA ORF Clone, Human, N-HA tag

SPD-10201

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Human myocyte enhancer factor 2A with N terminal HA tag.
Target Information
Species Human
Target Name MEF2A
Gene Abbr. MEF2A
Gene ID 4205
Full Name myocyte enhancer factor 2A
Alias ADCAD1, RSRFC4, RSRFC9, mef2
Introduction MEF2A is a member of the MEF2 (myocyte enhancer factor 2) family of transcription factors. In mammals, four MEF2A-related genes (MEF2A, MEF2B, MEF2C and MEF2D) encode proteins which exhibit significant amino acid sequence similarity within their DNA binding domains and to a lesser extent throughout the remaining proteins. The MEF2 family members were originally described as muscle-specific DNA binding proteins that recognize MEF2 motifs found within the promoters of many muscle-specific genes. Phosphorylation of MEF2A at Thr312 and Thr319 within the transcription activation domain by p38 MAP kinase enhances MEF2A-MEF2D heterodimer-dependent gene expression. On the other hand, apoptotic stimuli (e.g. neurotoxic insult) result in CDK5-dependent phosphorylation of MEF2A at Ser408 within the activation domain, inhibiting MEF2A pro-survival function.
Product Details
Description Full length Clone DNA of Human myocyte enhancer factor 2A with N terminal HA tag.
NCBI Ref Seq BC013437
RefSeq ORF Size 1500 bp
Vector pCMV3-N-HA
Promoter Enhanced CMV promoter
Tag Sequence HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.