Online Inquiry
MEF2A cDNA ORF Clone, Human, C-His tag
SPD-10194
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| Full length Clone DNA of Human myocyte enhancer factor 2A with C terminal His tag. |
| Target Information | |
|---|---|
| Species | Human |
| Target Name | MEF2A |
| Gene Abbr. | MEF2A |
| Gene ID | 4205 |
| Full Name | myocyte enhancer factor 2A |
| Alias | ADCAD1, RSRFC4, RSRFC9, mef2 |
| Introduction | MEF2A is a member of the MEF2 (myocyte enhancer factor 2) family of transcription factors. In mammals, four MEF2A-related genes (MEF2A, MEF2B, MEF2C and MEF2D) encode proteins which exhibit significant amino acid sequence similarity within their DNA binding domains and to a lesser extent throughout the remaining proteins. The MEF2 family members were originally described as muscle-specific DNA binding proteins that recognize MEF2 motifs found within the promoters of many muscle-specific genes. Phosphorylation of MEF2A at Thr312 and Thr319 within the transcription activation domain by p38 MAP kinase enhances MEF2A-MEF2D heterodimer-dependent gene expression. On the other hand, apoptotic stimuli (e.g. neurotoxic insult) result in CDK5-dependent phosphorylation of MEF2A at Ser408 within the activation domain, inhibiting MEF2A pro-survival function. |
| Product Details | |
|---|---|
| Description | Full length Clone DNA of Human myocyte enhancer factor 2A with C terminal His tag. |
| NCBI Ref Seq | BC013437 |
| RefSeq ORF Size | 1500 bp |
| Vector | pCMV3-C-His |
| Promoter | Enhanced CMV promoter |
| Tag Sequence | His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC |
| Quality Control | The plasmid is confirmed by full-length sequencing. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
| Usage | |
|---|---|
| Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
| Antibiotic in E.coli | Kanamycin |
| Antibiotic in Mammalian cell | Hygromycin |
| Application | Stable or Transient mammalian expression |
| Shipping | Each tube contains lyophilized plasmid. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.