Online Inquiry
MDM2 Knockout Cell Line
SPL-02081
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 8bp deletion |
| Target Information | |
|---|---|
| Target Name | MDM2 |
| Gene Abbr. | MDM2 |
| Gene ID | 4193 |
| Full Name | MDM2 proto-oncogene |
| Alias | ACTFS, HDMX, LSKB, hdm2 |
| Species | Human |
| Genomic Locus | chr12:68813575 |
| Transcript | NM_002392 |
| WT Expression Level | 48.67 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | This gene encodes a nuclear-localized E3 ubiquitin ligase. The encoded protein can promote tumor formation by targeting tumor suppressor proteins, such as p53, for proteasomal degradation. This gene is itself transcriptionally-regulated by p53. Overexpression or amplification of this locus is detected in a variety of different cancers. There is a pseudogene for this gene on chromosome 2. Alternative splicing results in a multitude of transcript variants, many of which may be expressed only in tumor cells. [provided by RefSeq, Jun 2013]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 8bp deletion in a coding exon of MDM2. |
| Description | 8bp deletion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | TTGAAGTTATTAAAGTCTGT |
| PCR Primer |
Forward: ATGATTAGATCCTCCCCAGCATTTT Reverse: GTTCCTAGCTGAGAAATGAAACTCG |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.