Online Inquiry
MDM2 cDNA ORF Clone, Human, C-FLAG tag
SPD-10182
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
Full length Clone DNA of Human MDM2 oncogene, E3 ubiquitin protein ligase with C terminal Flag tag. |
Target Information | |
---|---|
Species | Human |
Target Name | MDM2 |
Gene Abbr. | MDM2 |
Gene ID | 4193 |
Full Name | MDM2 proto-oncogene |
Alias | ACTFS, HDMX, LSKB, hdm2 |
Introduction | MDM2, a ubiquitin ligase for p53, plays a central role in regulation of the stability of p53. Akt-mediated phosphorylation of MDM2 at Ser166 and Ser186 increases its interaction with p300, allowing MDM2-mediated ubiquitination and degradation of p53. Phosphorylation of MDM2 also blocks its binding to p19ARF, increasing the degradation of p53. |
Product Details | |
---|---|
Description | Full length Clone DNA of Human MDM2 oncogene, E3 ubiquitin protein ligase with C terminal Flag tag. |
NCBI Ref Seq | NM_002392.3 |
RefSeq ORF Size | 1494 bp |
Sequence Information | Identical with the Gene Bank Ref. ID sequence. |
Vector | pCMV3-C-FLAG |
Promoter | Enhanced CMV promoter |
Tag Sequence | FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG |
Restriction Sites | KpnI + NotI (6kb + 1.54kb) |
Quality Control | The plasmid is confirmed by full-length sequencing. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
Usage | |
---|---|
Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
Antibiotic in E.coli | Kanamycin |
Antibiotic in Mammalian cell | Hygromycin |
Application | Stable or Transient mammalian expression |
Shipping | Each tube contains lyophilized plasmid. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.