Online Inquiry
MBD3 Knockout Cell Line
SPL-02064
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 64bp insertion |
| Target Information | |
|---|---|
| Target Name | MBD3 |
| Gene Abbr. | MBD3 |
| Gene ID | 53615 |
| Full Name | methyl-CpG binding domain protein 3 |
| Species | Human |
| Genomic Locus | chr19:1585191 |
| Transcript | NM_001281454 |
| WT Expression Level | 47.97 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | DNA methylation is the major modification of eukaryotic genomes and plays an essential role in mammalian development. This gene belongs to a family of nuclear proteins which are characterized by the presence of a methyl-CpG binding domain (MBD). The encoded protein is a subunit of the NuRD, a multisubunit complex containing nucleosome remodeling and histone deacetylase activities. Unlike the other family members, the encoded protein is not capable of binding to methylated DNA. The protein mediates the association of metastasis-associated protein 2 with the core histone deacetylase complex. Alternative splicing results in multiple transcript variants of this gene. [provided by RefSeq, Jul 2013]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 64bp insertion in a coding exon of MBD3. |
| Description | 64bp insertion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | CTGCGGAACTTCTTCCCGCT |
| PCR Primer |
Forward: GACCTGGTTGGAGGAGTCGTAG Reverse: GATCTAGGGGCCAGTTGTGG |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.