Online Inquiry
MBD2 Knockout Cell Line
SPL-02062
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 8bp deletion |
| Target Information | |
|---|---|
| Target Name | MBD2 |
| Gene Abbr. | MBD2 |
| Gene ID | 8932 |
| Full Name | methyl-CpG binding domain protein 2 |
| Alias | DMTase, NY-CO-41 |
| Species | Human |
| Genomic Locus | chr18:54205111 |
| Transcript | NM_003927 |
| WT Expression Level | 60.47 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | DNA methylation is the major modification of eukaryotic genomes and plays an essential role in mammalian development. Human proteins MECP2, MBD1, MBD2, MBD3, and MBD4 comprise a family of nuclear proteins related by the presence in each of a methyl-CpG binding domain (MBD). Each of these proteins, with the exception of MBD3, is capable of binding specifically to methylated DNA. MECP2, MBD1 and MBD2 can also repress transcription from methylated gene promoters. The protein encoded by this gene may function as a mediator of the biological consequences of the methylation signal. It is also reported that the this protein functions as a demethylase to activate transcription, as DNA methylation causes gene silencing. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2011]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 8bp deletion in a coding exon of MBD2. |
| Description | 8bp deletion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | GCCTCAGTTGGCAAGGTACC |
| PCR Primer |
Forward: ACATTTGGACAACCAAAATTCCAGT Reverse: AGAATGGGGTATCAATTGAGGGTAG |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.