Online Inquiry
MBD1 Knockout Cell Line
SPL-02059
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
287bp insertion |
Target Information | |
---|---|
Target Name | MBD1 |
Gene Abbr. | MBD1 |
Gene ID | 4152 |
Full Name | methyl-CpG binding domain protein 1 |
Alias | CXXC3, PCM1, RFT |
Species | Human |
Genomic Locus | chr18:50279891 |
Transcript | NM_001204140 |
WT Expression Level | 36.89 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
Introduction | The protein encoded by this gene is a member of a family of nuclear proteins related by the presence of a methyl-CpG binding domain (MBD). These proteins are capable of binding specifically to methylated DNA, and some members can also repress transcription from methylated gene promoters. This protein contains multiple domains: MBD at the N-terminus that functions both in binding to methylated DNA and in protein interactions; several CXXC-type zinc finger domains that mediate binding to non-methylated CpG dinucleotides; transcriptional repression domain (TRD) at the C-terminus that is involved in transcription repression and in protein interactions. Numerous alternatively spliced transcript variants encoding different isoforms have been noted for this gene.[provided by RefSeq, Feb 2011]. |
Product Details | |
---|---|
Cell Line Model | HAP1 |
Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 287bp insertion in a coding exon of MBD1. |
Description | 287bp insertion |
Parental Cell Line | C631 |
Guide RNA Sequence | ATAGGTGTCTGAGCGTCCAC |
PCR Primer |
Forward: TTCACTGCTCTGTACGTATTCTTGA Reverse: GCACTAATGGATACCAGTGATTTGT |
Handling Specifications | |
---|---|
Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
Culture Medium | IMDM + 10% FCS |
Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
Freeze Medium | IMDM + 20% FCS + 10% DMSO |
Biosafety Level | BSL-1 |
Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.