MBD1 Knockout Cell Line - CD BioSciences

service-banner

MBD1 Knockout Cell Line

MBD1 Knockout Cell Line

SPL-02058

Size Price
1 Unit Online Inquiry
Description
1bp deletion
Target Information
Target Name MBD1
Gene Abbr. MBD1
Gene ID 4152
Full Name methyl-CpG binding domain protein 1
Alias CXXC3, PCM1, RFT
Species Human
Genomic Locus chr18:50279891
Transcript NM_001204140
WT Expression Level 36.89 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing)
Introduction The protein encoded by this gene is a member of a family of nuclear proteins related by the presence of a methyl-CpG binding domain (MBD). These proteins are capable of binding specifically to methylated DNA, and some members can also repress transcription from methylated gene promoters. This protein contains multiple domains: MBD at the N-terminus that functions both in binding to methylated DNA and in protein interactions; several CXXC-type zinc finger domains that mediate binding to non-methylated CpG dinucleotides; transcriptional repression domain (TRD) at the C-terminus that is involved in transcription repression and in protein interactions. Numerous alternatively spliced transcript variants encoding different isoforms have been noted for this gene.[provided by RefSeq, Feb 2011].
Product Details
Cell Line Model HAP1
Genotype HAP1 cell line, edited by CRISPR/Cas to contain a 1bp deletion in a coding exon of MBD1.
Description 1bp deletion
Parental Cell Line C631
Guide RNA Sequence ATAGGTGTCTGAGCGTCCAC
PCR Primer Forward: TTCACTGCTCTGTACGTATTCTTGA
Reverse: GCACTAATGGATACCAGTGATTTGT
Handling Specifications
Revival Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish.
Culture Medium IMDM + 10% FCS
Growth Properties Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20.
Freeze Medium IMDM + 20% FCS + 10% DMSO
Biosafety Level BSL-1
Disclaimer This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.