MAX cDNA ORF Clone, Human, C-Myc tag - CD BioSciences

service-banner

MAX cDNA ORF Clone, Human, C-Myc tag

MAX cDNA ORF Clone, Human, C-Myc tag

SPD-10075

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Human MYC associated factor X with C terminal Myc tag.
Target Information
Species Human
Target Name Max
Gene Abbr. MAX
Gene ID 4149
Full Name MYC associated factor X
Alias bHLHd4
Introduction Members of the Myc/Max/Mad network function as transcriptional regulators with roles in various aspects of cell behavior including proliferation, differentiation and apoptosis. These proteins share a common basic-helix-loop-helix leucine zipper (bHLH-ZIP) motif required for dimerization and DNA-binding. Max was originally discovered based on its ability to associate with c-Myc and found to be required for the ability of Myc to bind DNA and activate transcription. Subsequently, Max has been viewed as a central component of the transcriptional network, forming homodimers as well as heterodimers with other members of the Myc and Mad families. The association between Max and either Myc or Mad can have opposing effects on transcriptional regulation and cell behavior. The Mad family consists of four related proteins; Mad1, Mad2 (Mxi1), Mad3 and Mad4, and the more distantly related members of the bHLH-ZIP family, Mnt and Mga. Like Myc, the Mad proteins are tightly regulated with short half-lives. In general, Mad family members interfere with Myc-mediated processes such as proliferation, transformation and prevention of apoptosis by inhibiting transcription.
Product Details
Description Full length Clone DNA of Human MYC associated factor X with C terminal Myc tag.
NCBI Ref Seq NM_145112.2
RefSeq ORF Size 501 bp
Sequence Information Identical with the Gene Bank Ref. ID sequence.
Vector pCMV3-C-Myc
Promoter Enhanced CMV promoter
Tag Sequence Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Restriction Sites KpnI + XbaI (6kb + 0.5kb)
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.