Online Inquiry
MATK Knockout Cell Line
SPL-02057
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 7bp deletion |
| Target Information | |
|---|---|
| Target Name | MATK |
| Gene Abbr. | MATK |
| Gene ID | 4145 |
| Full Name | megakaryocyte-associated tyrosine kinase |
| Alias | CHK, CTK, HHYLTK, HYL, HYLTK |
| Species | Human |
| Genomic Locus | chr19:3784410 |
| Transcript | NM_139354 |
| WT Expression Level | 23.21 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | The protein encoded by this gene has amino acid sequence similarity to Csk tyrosine kinase and has the structural features of the CSK subfamily: SRC homology SH2 and SH3 domains, a catalytic domain, a unique N terminus, lack of myristylation signals, lack of a negative regulatory phosphorylation site, and lack of an autophosphorylation site. This protein is thought to play a significant role in the signal transduction of hematopoietic cells. It is able to phosphorylate and inactivate Src family kinases, and may play an inhibitory role in the control of T-cell proliferation. This protein might be involved in signaling in some cases of breast cancer. Three alternatively spliced transcript variants that encode different isoforms have been described for this gene. [provided by RefSeq, Jul 2008]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 7bp deletion in a coding exon of MATK. |
| Description | 7bp deletion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | CTCGCATTTGGTGATACACT |
| PCR Primer |
Forward: TACCAGCTCTTGTTCTGCCA Reverse: ATCTCCGTGATGTCCTCCCTTT |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.